Replication is usually dependent on host functions, such as DNA polymerases, but regulation of plasmid replication is distinct from that of the host chromosome. Transcriptome-wide analyses of 5-ends in RNase J mutants of a gram-positive pathogen reveal a role in RNA maturation, regulation and degradation. Moreover, the lack of RNA1 is epistatic to the lack of RNase J1, since pVG1[PRNA1] was able to replicate in the RNase J1 mutant (Figure 8). The importance of an RNase as essential host-factor is highlighted by the fact that the copy-number of many other plasmid families (e.g., ColEI, R1 and pT181) is also regulated negatively by short RNA molecules (del Solar and Espinosa, 2000). More distantly related plasmids are also recognizably part of the same family; for example the pUSA300-HOU-MS and pSK1 RepA_N proteins are 99% and 68% identical to pSA564 RepA_N, respectively (Table 1). Protein levels were quantified by Bradford solution diluted five times (Bio-Rad Assay Dye Reagent Concentrate, #500-0006). Plasmid replication control mechanisms are important determinants of plasmid inheritance as they ensure the presence of sufficient plasmid copies in the cell prior to cell division. Mechanism of Theta Plasmid Replication: DNA unwinds at the ori site from where the replication begins. Plasmid copy number control: an ever-growing story. The GGUPCC mutation (red nucleotides in insert) also weakens the UTR-SLII stem, which presumably shifts the equilibrium toward formation of UTR-SLIII(TT). Firth, N., Jensen, S. O., Kwong, S. M., Skurray, R. A., and Ramsay, J. P. (2018). Received: 24 July 2020; Accepted: 06 April 2021;Published: 04 May 2021. doi: 10.1016/j.plasmid.2014.09.003, Shokeen, S., Greenfield, T. J., Ehli, E. A., Rasmussen, J., Perrault, B. E., and Weaver, K. E. (2009). Durand, S., Tomasini, A., Braun, F., Condon, C., and Romby, P. (2015). (D) The putative secondary structure of RNA1, where RNA1-SLII doubles as kissing loop and a transcription terminator. This accumulation inhibits RepA production, thus making RNase J an essential host-factor for pSA564 replication. 1979). Replication control of staphylococcal multiresistance plasmid pSK41: an antisense RNA mediates dual-level regulation of Rep expression. doi: 10.1016/j.plasmid.2008.11.004, Xu, F., Lin-Chao, S., and Cohen, S. N. (1993). And would such a duplex really prevent formation of the proposed ON-structure? For RNA isolation, cultures were grown until mid-exponential phase (OD600 of 0.4) and harvested by rapidly mixing with five volumes of cold ethanol/acetone (1:1 vol:vol). J. Bacteriol. (C,D) Rifampicin was used to block transcription and RNA was extracted at different time points to follow the rate of degradation by Northern blotting. PR01 was transformed with pRacUTR and pUTR269. Details of the mutations in pVG1 can be found in Table 2. 12, 658674. The plasmid furthermore encodes a beta-lactamase, a cadmium transporter and three enterotoxin genes, as well as several hypothetical protein genes (Supplementary Figure 1). The green section was cloned from pSA564, and includes (from left to right) a truncated rep1_N gene, the rac gene, the RNA1 gene, and the repA_N gene. 23, 451454. The pVG1[PRNA1] was readily established in the rnjA strain, whereas the pVG1 plasmid was not, demonstrating that RNA1 is essential for the plasmid-loss observed in RNase J mutants. Cop. Analysis of the pSK1 replicon, a prototype from the staphylococcal multiresistance plasmid family. The DNA oligo probes were 5 labeled with ATP [-32P] and Polynucleotide Kinase (Thermo Fischer Scientific) and hybridized to the membrane over night at 37C in ExpressHyb hybridization solution (Clontech, Mountain View, CA, United States). New range of vectors with a stringent 5-fluoroorotic acid-based counterselection system for generating mutants by allelic replacement in Staphylococcus aureus. We further examine which sequence elements on the antisense RNA and on its 5UTR target are needed for this regulation. doi: 10.1016/j.tim.2016.06.012, Nair, D., Memmi, G., Hernandez, D., Bard, J., Beaume, M., Gill, S., et al. It therefore appears that RNase J1 is not always the initator of RNA1 degradation, but that RNase J1 is required for degrading the 3 region of RNA1, i.e., a region which is sufficient for controlling pSA564 replication (see RNA1-18nt in Supplementary Figure 3). RN4220 exhibits similar colony, colony ratios for pVG1 and pVG1[PRNA1*] (blue and green bars, respectively), whereas only pVG1[PRNA1*] replicates rapidly in rnjA to form colonies within 24 h. Note that rnjA transformed with pVG1 will eventually form colonies when the plates are left long enough in the incubator. (E,F) A second probe (R2) against RNA1, this time targeting the 5-end was used to re-probe the same membrane as in (C,D), respectively. Plasmid P1 replication is dependent, both in vivo and in vitro, on the specific initiator protein RepA (6, 313) and on the host DnaA protein (110, 313). These suspensions were used for serial dilutions that were then spotted on MH, MHC, MHP, and MHCP agar-plates and incubated over night at 37C. 400 g/ml rifampicin was added to the cultures and samples were taken at five time points: 0, 75, 150, 300, and 600 s. Each sample of 6 ml was harvested by rapid mixing with 30 ml cold 1:1 ethanol:acetone solution. Bacterial cultures at OD600 of 0.4 (20 mL) were centrifuged (5,000 g, 4C, 10 min) and the pellet was lysed with 1 mL of PBS buffer (MgCl2 + CaCl2) (DPBS D8662, Sigma-Aldrich), anti-protease (cOmplete, Mini, EDTAfree Protease Inhibitor Cocktail, Sigma-Aldrich), lysostaphin (Ambi products, Lawrence, NY, United States) to a final concentration of 200 g/ml and DNase I (M0303S; New England Biolabs) at a final concentration of 1 l/ml for 15 min at 37C. Interestingly, the long RNA1 fragments that are visible with both the R1 and R2 probes in the rnjA RNA are not detected in the wild-type strain (Figures 9E,F), and it seems likely that these are normally degraded from their 5 end by the 5 to 3 exoribonucleolytic activity of RNase J1. The first construct, pRacUTR, had an insert that contained a disrupted rep_1 gene, the putative partitioning gene rac, as well as the promoter, 5 untranslated region (5UTR) and start codon of the repA gene (Figure 2A and Supplementary Figure 1). A type III-like restriction endonuclease functions as a major barrier to horizontal gene transfer in clinical Staphylococcus aureus strains. RNase J1 and J2 have previously been proposed as essential for degrading the toxin mRNA in the par toxin-antitoxin system of pAD1 from Enterococcus faecalis (Shokeen et al., 2009), and we cannot exclude that pSA564 carries a similar par-like toxin-antitoxin system which killed all plasmid-carrying cells when RNase J1 or J2 was deleted (leaving only the cells that have lost pSA564 to form colonies). Strain PR01 is a derivative of SA564 where the restriction systems have been inactivated to facilitate transformation, and the pyrFE genes have been deleted to facilitate genetic manipulations, but where pSA564 replication remains unchanged (Corvaglia et al., 2010; Redder and Linder, 2012). Plasmid 73, 1015. RNases have previously been observed to be required for plasmid replication in Gram-negative bacteria via degradation of regulatory RNAs (Saramago et al., 2015 and references therein), but this has to our knowledge not previously been seen in Firmicutes. Spectr. In contrast, the fragments that have lost their 5 ends in the rnjA RNA (undetected with the R2 probe, compare Figures 9D,F), must have been generated by an unidentified endoribonuclease, and only then degraded by RNase J1. Initiation of mRNA decay in bacteria. The RepA control mechanism is designed to shut off expression when the copy number rises, and the medium-copy number of the pVG9 constructs (determined by the pT181 replication mechanism and origin) was therefore expected to lead to a firm repression of RepA expression. sRNA and mRNA turnover in gram-positive bacteria. The 5UTR of the repA mRNA can form putative regulatory structures that are modified by hybridization with the antisense RNA1. PL and PR conceptualized the work. 2, PLAS00012013. Before this study, it was already known that the two RepA_N-family plasmids pSK1 and pSK41 produce a small antisense RNA as copy-number control molecule from the opposite strand of their repA_N 5UTR. There are two methods for the replication of plasmids. A GenBank analysis (performed in December 2019) showed that many S. aureus strains harbor plasmids highly similar to pSA564, with 683 sequenced plasmids encoding identical RepA_N proteins. The 5 untranslated region (5UTR) of the plasmid replication initiation gene (repA) potentially forms two mutually exclusive secondary structures, ON and OFF, where the latter both sequesters the repA ribosome binding site and acts as a rho-independent transcriptional terminator. Spectr. The green section was cloned from pSA564, and includes (from left to right) a truncated rep1_N gene, the rac gene, the RNA1 gene, and the repA_N gene. Sambrook, J. F., and Russel, D. W. (2001). doi: 10.1046/j.1365-2958.1997.5871953.x, Somerville, G. A., Beres, S. B., Fitzgerald, J. R., DeLeo, F. R., Cole, R. L., Hoff, J. S., et al. (A) Schematic linear map of the pVG9 construct. Cells were pelleted (4,000 g for 5 min), washed in 1 ml TE buffer, resuspended in 200 l TE with 10 g Lysostaphin (Sigma) and 40 U RNasin Plus (Promega), and incubated at 37C for 10 min. Cell 65, 12331242. MH medium was also included, as control for growth without requirement for a plasmid. This structure is favored by pairing of the mRNA with the complementary RNA as shown in (E). RBS indicates the GAGG RBS. This is accomplished by strong constitutive expression of the asRNA combined with its rapid degradation (Pritchard et al., 1969), and the plasmid thus relies on an efficient host-encoded RNA decay machinery to correctly regulate its copy-number (Saramago et al., 2015). The antisense RNA1 molecule potentially forms two stem loops (Zuker, 2003), RNA1-SLI and RNA1-SLII, where the downstream hairpin (SLII) doubles as a rho-independent transcriptional terminator due to the stretch of uridine residues that immediately follow it (Figure 1D). The result is an increase in plasmid copy number, an elegant solution to the limitation imposed by dependence of the plasmid on the replication machinery of its host, which restricts firing of replication origins to a single event per cell cycle (Zakian et al. Our highly similar findings for pSA564 show that this asRNA could be a universal system for this plasmid family. Figure 1. The observed differences in chloramphenicol resistance in Figure 5 could hypothetically be due to altered expression of the chloramphenicol resistance gene (for example via changes to supercoiling density), but the base-pair differences between the various pVG1 constructs are so small (maximum 12 substitutions) that we consider this an unlikely explanation. the plasmid or the host but inuence replication and partition of plasmids between daughter cells dur ing cultures (3). Staphylococcal Plasmids, transposable and integrative elements. J. Bacteriol. RNA1 degradation and abundance. Colonies were picked directly from the transformation MHC agar plate and resuspended in MH medium. Note that repeated attempts to transform PR02 with pVG1[GGUPCC] yielded no transformants, and this strain is therefore not included in the assay. Host-bacterial crosstalk determines Staphylococcus aureus nasal colonization. (H) Probe against 5S rRNA to normalize the membrane shown in (D,F). A strong band was observed for pVG9[PRNA1], which no longer produced RNA1 (Figure 6B). J. Bacteriol. (2015) with 8% acrylamide gels containing 8 M urea. Regulation of plasmid R1 replication: PcnB and RNase E expedite the decay of the antisense RNA. The region upstream of the repA gene contains two divergent genes, rac and rep1. (A) Schematic linear map of the pVG1 construct. 10:e1004207. Hfq, a protein which normally promotes RNA-RNA duplex formation in E. coli, appears to directly or indirectly prevent RNAI from interacting with the replication pre-primer RNAII, thus increasing replication of ColE1-like plasmids (Cech et al., 2014). The RepA_N replicons of Gram-positive bacteria: a family of broadly distributed but narrow host range plasmids. It is therefore possible that while RNAIII exhibits a long half-life in B. subtilis (Brantl and Wagner, 1996), it may have a short half-life (leading to more precise copy-number control) in S. agalactiae where the activity and specificity of the RNA degradation system might be different than in B. subtilis. Transformant colonies were resuspended in MH broth and plated on MH with chloramphenicol (MHC, to detect pRacUTR and pUTR269), MH with penicillin (MHP, to detect pSA564), and MH with both antibiotics (MHCP) (Figure 2B). We would like to thank Patrick Viollier, Jean-Yves Bouet, Leonora Poljak, and Dave Lane for critical reading of the manuscript. This is not the case when chromosome III, one of the smallest chromosomes, is forced to missegregate. Mutating the RNA1 promoter permits the detection of RepA by Western blotting. The paradigm for such regulation is that the regulating molecule must be short-lived (Pritchard et al., 1969; Wagner and Brantl, 1998), and it is therefore probable that RNase activities and specificities play a large role in determining the host-range of plasmids in general. Raj, R., Nadig, S., Patel, T., and Gopal, B. The supernatant was discarded, whereupon the pellet was washed with 1 mL of 75% cold ethanol and then centrifuged for 10 min at 7,500 g at 4C. Although the effect on bacterial growth is unknown, it is possible that by shifting the host cell from aerobic towards anaerobic metabolism, the plasmid may potentiate gut colonization, and thereby promote the fitness of both the bacterium and the plasmid in this niche. Plasmid 78, 2636. However, when 38 nts are removed (and this includes the putative RNA1-SLI hairpin), then the inhibitory effect is abolished (Supplementary Figure 3), which suggests that the putative RNA1-SLI secondary structure is required for RNA1 to shift the equilibrium of the repA 5UTR toward a structure that blocks RepA expression. N. Engl. Kissing and RNA stability in antisense control of plasmid replication. While S. aureus does encode an Hfq homolog, it does not appear to be implicated in RNA-RNA interactions, suggesting a different organization of sRNA-mediated regulation (Bohn et al., 2007). Intriguingly, pIP501 was discovered in Streptococcus agalactiae and presumably has a copy-number control mechanism which has evolved to fit the RNA decay system in that bacterium. 11:e1005577. Microbiol. In general, these types of plasmids tend to be low copy number. 37, 492500. RNA Biol. PLoS Genet. doi: 10.1128/AEM.70.10.6076-6085.2004, Corvaglia, A. R., Franois, P., Hernandez, D., Perron, K., Linder, P., and Schrenzel, J. The dependence on RNase J probably extends to all plasmids with pSA564-like replication origins, as well as to other members of the S. aureus RepA_N plasmid family, since all appear to be regulated by RNA1-UTR-type mechanisms and have narrow host-ranges (Weaver et al., 2009). The downstream RNase E cleavage products of RNAI and CopA are also able to inhibit plasmid replication (similar to RNA1-18nt, discussed above), and the rapid degradation of these intermediates requires the PAP I poly(A)polymerase. Phase Lock Gel tubes (5prime, Hilden, Germany) were used to separate the phases, according to the manufacturers protocol. 339, 520532. The Ribosome Binding Site (RBS) has been highlight with a red box. The supernatant was discarded; the pellet was air dried for 1520 min and the RNA pellet was resuspended in 20 L of TE 1 buffer. 12:586886. doi: 10.3389/fmicb.2021.586886. Thus, increasing copy-number of the plasmid will increase the concentration of antisense RNA, which in turn will block replication initiation (Kwong et al., 2006, 2008; Weaver et al., 2009). HEK293T cells was transfected with ORF1-Flag or EGFP-Flag plasmid, and cell lysates were incubated with Flag antibody. A 9-kb mini-F plasmid that contains the RepFIA region has two origins oriV and oriS and a single replication initiation protein Rep. Replication from oriV when both oriV and oriS are present is bidirectional, whereas replication from oriS when oriV is deleted is unidirectional (Keasling et al., 1992). Med. Copyright 2021 Guimares, Le Scornet, Khemici, Hausmann, Armitano, Prados, Jousselin, Manzano, Linder and Redder. To verify that loss of pSA564 in the RNase J mutant strains was directly linked to RNA1, we used pVG1 and pVG1[PRNA1] which contain only the replicon from pSA564. Figure 4. RNase J1 and J2 Are Host-Encoded Factors for Plasmid Replication. doi: 10.1093/nar/gkg595, Keywords: Staphylococcus aureus, plasmid replication control, RNase J, antisense RNA, essential host factors, Citation: Guimares VA, Le Scornet A, Khemici V, Hausmann S, Armitano J, Prados J, Jousselin A, Manzano C, Linder P and Redder P (2021) RNase J1 and J2 Are Host-Encoded Factors for Plasmid Replication. 39, 316330. (B) The proposed OFF-structure of the repA UTR, where CCMID and GGDW base-pairs in the UTR-SLIII(TT) stem-loop to form a rho-independent transcriptional terminator, and at the same time sequester the RBS. We analyzed the mechanism of recombination-dependent DNA replication in bacteriophage T4-infected Escherichia coli using plasmids that have sequence homology to the infecting phage chromosome. Lobanovska, M., and Pilla, G. (2017). 8 Articles, This article is part of the Research Topic, https://doi.org/10.3389/fmicb.2021.586886, https://www.frontiersin.org/articles/10.3389/fmicb.2021.586886/full#supplementary-material, https://www.ncbi.nlm.nih.gov/pubmed/?term=PMID%3A+7476142, Creative Commons Attribution License (CC BY). We then examined how RNA1 controls repA expression by modifying pVG1 in several ways: (i) abolishing the production of RNA1 (pVG1[PRNA1]), (ii) weakening the putative kissing interaction between the RNA1-SLII loop and the repA mRNA (pVG1[kiss]), (iii) reducing formation of both putative secondary structures of the 5UTR by mutating CCMID to GG (pVG1[CCMIDGG]), which at the same time will abolish duplex formation with the RBS, (iv) reducing formation of the proposed ON-structure of the 5UTR by mutating GGUP to CC (pVG1[GGUPCC]), or (v) reducing formation of the proposed OFF-structure of the 5UTR by mutating both GGUP to CC and CCMID to GG (pVG1[GGUPCC, CCMIDGG]) (summarized in Table 2 and Figure 3). 4 to 8 g of total RNA (depending on experiment) was loaded in each lane and the marker was RiboRuler Low Range RNA Ladder (Thermo Scientific). Plasmid 78, 416. pEB01 carries a chloramphenicol resistance cassette and the pT181 origin for replication in S. aureus (Charpentier et al., 2004; Giraud et al., 2015). doi: 10.1073/pnas.90.14.6756, Zuker, M. (2003). doi: 10.1073/pnas.1000489107, del Solar, G., and Espinosa, M. (2000). However, the shorter RNA1-38nt was unable to cause the loss of pSA564, and Northern blotting therefore detected both full-length RNA1 from pSA564 and RNA1-38nt from pRNA1-38nt (Supplementary Figure 3D). We were unable to do this directly in the rnjA strain, since it has lost the pSA564 plasmid, so we transformed both the rnjA and the parental PR01 strains with pRacUTR, which replicates via the pT181 origin of replication and expresses RNA1 and the repA 5UTR (but not the repA coding region). Sci. doi: 10.1099/mic.0.2008/017418-0, Kwong, S. M., Skurray, R. A., and Firth, N. (2006). doi: 10.1128/JB.00030-06, Laalami, S., Zig, L., and Putzer, H. (2014). doi: 10.1371/journal.pgen.1005577, Kwong, S. M., and Firth, N. (2015). The. (iii) Host colonization. The RNA was pelleted by 40 min of centrifugation at 12,000 g and 4C. Restriction enzymes were from New England Biolabs (Ipswich, MA, United States) and PCR products used for cloning were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs). doi: 10.4161/rna.22899, Prados, J., Linder, P., and Redder, P. (2016). Microbiol. Biology of the staphylococcal conjugative multiresistance plasmid pSK41. Acad. To determine whether the plasmid-loss effect was due to an accumulation of RNA1 (as would be expected in a mutant deficient in RNA degradation), we examined the stability of RNA1 in the wild-type and rnjA strains (Figure 9). We therefore wanted to identify the host-factors needed to ensure rapid degradation of RNA1, and we argued that the lack of such a host-factor would lead to accumulation of RNA1 and subsequent loss of pSA564. doi: 10.1128/JB.00027-11, Oun, S., Redder, P., Didier, J.-P., Franois, P., Corvaglia, A.-R., Buttazzoni, E., et al. Each paralog has different activities and specificities, which are modified when the paralogs form a hetero-protein complex (Mathy et al., 2010; Linder et al., 2014; Raj et al., 2020). Genetic requirements for replication initiation of the staphylococcal multiresistance plasmid pSK41. (B) The pVG1 plasmid and its derivatives were transformed into PR01, plated on MHC agar plates and incubated over night at 37C. These data are all consistent with an antisense RNA based plasmid replication control system of the same type as pSK41 and pSK1 (Kwong et al., 2006, 2008; Kwong and Firth, 2015), and we decided to name the antisense RNA from pSA564 RNA1.. Further details about the pSA564 insert can be found in Supplementary Figure 1. J. Mol. Plasmid 70, 4251. Mutating PAP I lowers the copy-numbers of both ColE1 and R1, but does not cure these plasmids (Xu et al., 1993; Sderbom et al., 1997). (G) Probe against 5S rRNA to normalize the membrane shown in (C,E). The host's vegetative RNA polymerase synthesizes an initiator RNA (RNAII) and, from the opposite strand, a copy-number regulator (RNAI). We furthermore show that the level of RNA1 is regulated by RNase J-dependent degradation, and that RNA1 accumulates in RNase J mutant strains. VG, AJ, PL, and PR wrote the manuscript. VG, AL, VK, SH, AJ, CM, and PR performed the experiments. These mutants of the RNA decay machinery were spotted on penicillin plates to test for the presence of pSA564. Little is known about RNA decay in S. agalactiae, but both RNase J1 and J2 are essential in Streptococcus pyogenes, whereas they are both non-essential in B. subtilis (Bugrysheva and Scott, 2010; Figaro et al., 2013). Similarities between RepA from pSA564 and RepA from other staphylococcal plasmids. The CshA DEAD-box RNA helicase is important for quorum sensing control in Staphylococcus aureus. The location of the rac promoter is unknown. RNase E is unfortunately essential in E. coli, but it is possible that deleting RNase E would have the same dramatic effect that we observe for pSA564 when we delete RNase J1. The origin of replication of the broad-host-range plasmid R6K ( oriR6K) has been used to construct conditionally replicative cloning and transposon delivery vectors too numerous to cite them all, with some of the most well-known vectors described in the late 1980s and early 1990s [ 1 - 6 ]. Fat lines indicate RNA, with key nucleotides shown. (B) Level of RNA1 is similar for pSA564 and pRacUTR in PR01, but the overall intensity of the combined RNA1 bands are much higher in rnjA. To examine whether pSA564 replication is regulated by a small transcript (in the same way as pSK1 and pSK41), we generated two constructs using the multi-copy vector pEB01 as backbone. Further details about the pSA564 insert and the backbone cloning vector can be found in Supplementary Figure 1. (2014). A major problem of S. aureus infection is the frequent presence of antibiotic resistant strains which are difficult to eradicate. The minor band observed below the main RNA1 signal is presumably a fragment of RNA1, since it is absent from the S. aureus strain RN4220 which carries no plasmid. RNases and helicases in gram-positive bacteria. The levels of RepA expressed from the various pVG9 mutants (Figure 6) correspond to the observations of relative plasmid copy number (Figure 5). Here, we show that EBNA1 forms a cell cycle-dependent DNA crosslink with the EBV origin of plasmid replication oriP. Although most viroids and virusoids do not encode proteins, hepatitis D virus does. Spectr. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). Equal amounts (10 to 20 g total protein) of lysates were prepared in loading buffer (4x = bromophenol blue 0,4% + 200mM Tris pH 6,8 + 40% glycerol + 8% SDS), migrated on precast 8% SDS-PAGE Gel (Eurogentec, ID-PA4121-015) in 1 MOPS buffer at 150V for 1 h. The PVDF membrane was activated by 30 s in methanol, 5 min in water and 10 min in 1 transfer buffer (tris base 0.25 M and glycine 1.9 M). Colonies from the transformation were picked, sequentially diluted 10-fold and spotted on Mueller-Hinton plates containing either no antibiotic, chloramphenicol, penicillin G, or both antibiotics. All the strains compared in the figures were spotted on the same agar plate. 75, 731743. The rate of processing and degradation of antisense RNAI regulates the replication of ColE1-type plasmids in vivo. Such slower growing bacteria will presumably be outcompeted in nature, unless a continuous selection pressure is maintained (for example with penicillin). However, these strains were mutants that had been generated several years ago (Redder and Linder, 2012), and we had no direct proof that their parental strain was carrying pSA564 when the mutations were made. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. For example, deletion of RNase J1 or J2 in S. aureus causes severe growth defects and leads to the accumulation of hundreds of RNA species (Linder et al., 2014), whereas in B. subtilis it is RNase Y deletion mutants that exhibit the most severe defects (Figaro et al., 2013). All methods of standard molecular biology techniques used, were performed by the methods of Molecular cloning: a laboratory manual (Sambrook and Russel, 2001) or according to the recommendations of the manufacturers. The plasmid encoding the PA subunit of A/WSN/33 was substituted with the mutated PA plasmid to obtain recombinant viruses containing PA-E18G, -E23K and . PLoS ONE 5:e10725. Therefore, to ensure that the penicillin sensitivity was not an artifact of these phenotypes, we re-analyzed our previously published whole genome sequencing data from our rnjA and rnjB mutants (Linder et al., 2014) and confirmed that no pSA564-derived sequences could be detected, which established that our RNase J1 and J2 mutants strains had indeed lost pSA564. doi: 10.1016/j.plasmid.2014.07.004, Brantl, S., and Wagner, E. G. (1996). Further details about the pSA564 insert can be found in Supplementary Figure 1. A prerequisite for regulation of gene expression by antisense RNAs is that the intra-cellular concentrations of these regulators tightly follow the concentration of the regulated plasmids. These are distinguished by a central CC dinucleotide (CCMID) which can base-pair with either an upstream or downstream GG dinucleotide (GGUP and GGDW, respectively). RNAIII from pIP501 is an example of a very stable replication-inhibiting asRNA, with a half-life of about 30 min in B. subtilis (Brantl and Wagner, 1996). pVG1 and pVG1[PRNA1] transformation is scored as the number of colonies growing on MHC divided by the number of colonies growing on MHT. Plasmid-mediated phage defence that leads to phage abortive infection systems was reported to be linked to the presence of a plasmid encoded toxin-antitoxin pair system, which is able to. It carries pSA564 but the restriction systems have been knocked out to allow transformation with plasmids isolated from E. coli. Mol. doi: 10.1006/jmbi.1996.0023, Bugrysheva, J. V., and Scott, J. R. (2010). Whole-genome sequencing of Staphylococcus aureus strain RN4220, a key laboratory strain used in virulence research, identifies mutations that affect not only virulence factors but also the fitness of the strain. RNA Biol 10, 157165. 90, 135145. Importantly, neither the unrelated vector pEB01 (which carries pT181 replication machinery), nor growth on chloramphenicol in itself caused loss of pSA564. The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s. Probe R1: TTGGCGTAGCATCGACTCTCGGTAATAAAACGATTCGCA, Probe R2: ATTCGTCTGTTTATATAATTTTTTG, 5S rRNA probe: TTAACTTCTGTGTTCGGCATGGGAACAGGTGTGA CCTCC. Their activity will therefore be a key determinant for the host-range of pSA564. doi: 10.1128/jb.184.5.1430-1437.2002, Srouji, J. R., Xu, A., Park, A., Kirsch, J. F., and Brenner, S. E. (2017).

Young, Gifted And Black Album, Why Does Dilution Decrease Buffer Capacity, Elementor Space Between Widgets, Franklin High School Application, How To Include Other Files In Java, Gradle Generated Resources, How To Stick Photos On Wall Without Damaging, Colombia Women's Soccer Team,